splitseq {seqinr} | R Documentation |
Split a sequence into sub-sequences of 3 (the default size) with no overlap between the sub-sequences.
splitseq(seq, frame = 0, word = 3)
seq |
a vector of chars |
frame |
an integer (0, 1, 2) giving the starting position to split the sequence |
word |
an integer giving the size of the sub-sequences |
This function returns a vector which contains the sub-sequences.
J.R. Lobry
citation("seqinr")
cds <- s2c("aacgttgcaggtcgctcgctacgtagctactgttt") ## To obtain the codon sequence in frame 0: splitseq(cds) ## Show the effect of frame and word with a ten char sequence: (tenchar <- s2c("1234567890")) splitseq(tenchar, frame = 0) splitseq(tenchar, frame = 1) splitseq(tenchar, frame = 2) splitseq(tenchar, frame = 0, word = 2) splitseq(tenchar, frame = 0, word = 1)