Last updated on 2020-11-09 07:52:16 CET.
| Flavor | Version | Tinstall | Tcheck | Ttotal | Status | Flags |
|---|---|---|---|---|---|---|
| r-devel-linux-x86_64-debian-clang | 0.99.23 | 10.11 | 105.13 | 115.24 | ERROR | |
| r-devel-linux-x86_64-debian-gcc | 0.99.23 | 7.52 | 77.55 | 85.07 | ERROR | |
| r-devel-linux-x86_64-fedora-clang | 0.99.23 | 148.20 | ERROR | |||
| r-devel-linux-x86_64-fedora-gcc | 0.99.23 | 130.41 | ERROR | |||
| r-devel-windows-ix86+x86_64 | 0.99.23 | 23.00 | 139.00 | 162.00 | OK | |
| r-patched-linux-x86_64 | 0.99.23 | ERROR | ||||
| r-patched-solaris-x86 | 0.99.23 | 200.80 | ERROR | |||
| r-release-linux-x86_64 | 0.99.23 | 9.44 | 95.79 | 105.23 | ERROR | |
| r-release-macos-x86_64 | 0.99.23 | OK | ||||
| r-release-windows-ix86+x86_64 | 0.99.23 | 35.00 | 154.00 | 189.00 | OK | |
| r-oldrel-macos-x86_64 | 0.99.23 | NOTE | ||||
| r-oldrel-windows-ix86+x86_64 | 0.99.23 | 11.00 | 84.00 | 95.00 | ERROR |
Version: 0.99.23
Check: examples
Result: ERROR
Running examples in 'poplite-Ex.R' failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: External methods
> ### Title: Specific methods for generics defined in external packages.
> ### Aliases: filter select
> ### Keywords: utilities
>
> ### ** Examples
>
> if (require(Lahman))
+ {
+ baseball.teams <- makeSchemaFromData(TeamsFranchises, name="team_franch")
+ baseball.teams <- append(baseball.teams, makeSchemaFromData(Teams, name="teams"))
+
+ relationship(baseball.teams, from="team_franch", to="teams") <- franchID ~ franchID
+
+ baseball.db <- Database(baseball.teams, tempfile())
+
+ populate(baseball.db, teams=Teams, team_franch=TeamsFranchises)
+
+ select(baseball.db, .tables="teams")
+
+ select(baseball.db, .tables=c("teams", "team_franch"))
+
+ select(baseball.db, yearID:WCWin, franchName)
+
+ filter(baseball.db, active == "Y")
+
+ select(filter(baseball.db, active == "Y" & W > 50 & teamID == "CAL"), active, W, teamID)
+ }
Loading required package: Lahman
Starting team_franch
Starting teams
Warning: `select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
Warning: call dbDisconnect() when finished working with a connection
Error in UseMethod("select_") :
no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Calls: select ... join -> join -> .local -> .get.select.cols -> select_
Execution halted
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-patched-linux-x86_64, r-release-linux-x86_64
Version: 0.99.23
Check: tests
Result: ERROR
Running 'testthat.R' [30s/35s]
Running the tests in 'tests/testthat.R' failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
-- Warning (test-poplite.R:598:5): Querying with Database objects --------------
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
-- ERROR (test-poplite.R:655:5): Querying with Database objects ----------------
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
x
1. \-poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. +-dplyr::select_(.data, .dots = use.dots)
3. \-poplite:::select_.Database(.data, .dots = use.dots)
4. +-poplite:::join(.data, use.tables)
5. \-poplite:::join(.data, use.tables)
6. \-poplite:::.local(obj, ...)
7. \-dplyr::select_(...)
-- ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ----------
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
x
1. +-base::as.data.frame(...) test-poplite.R:883:4
2. \-poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. +-dplyr::select_(.data, .dots = use.dots)
4. \-poplite:::select_.Database(.data, .dots = use.dots)
5. +-dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. +-poplite:::join(.data, use.tables)
7. \-poplite:::join(.data, use.tables)
8. \-poplite:::.local(obj, ...)
9. \-dplyr::select_(...)
== testthat results ===========================================================
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-devel-linux-x86_64-debian-clang
Version: 0.99.23
Check: re-building of vignette outputs
Result: WARN
Error(s) in re-building vignettes:
...
--- re-building 'poplite.Rnw' using Sweave
Loading required package: dplyr
Attaching package: 'dplyr'
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Loading required package: DBI
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
Error in makeSchemaFromData(dna, "dna") :
ERROR: The names of the supplied data.frame need to be modified for the database see correct.df.names
Starting clinical
Starting samples
Starting dna
Warning: `select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
Error: processing vignette 'poplite.Rnw' failed with diagnostics:
chunk 9
Error in UseMethod("select_") :
no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
--- failed re-building 'poplite.Rnw'
SUMMARY: processing the following file failed:
'poplite.Rnw'
Error: Vignette re-building failed.
Execution halted
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-patched-linux-x86_64, r-patched-solaris-x86, r-release-linux-x86_64
Version: 0.99.23
Check: tests
Result: ERROR
Running ‘testthat.R’ [23s/37s]
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
── Warning (test-poplite.R:598:5): Querying with Database objects ──────────────
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
── ERROR (test-poplite.R:655:5): Querying with Database objects ────────────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. └─poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. ├─dplyr::select_(.data, .dots = use.dots)
3. └─poplite:::select_.Database(.data, .dots = use.dots)
4. ├─poplite:::join(.data, use.tables)
5. └─poplite:::join(.data, use.tables)
6. └─poplite:::.local(obj, ...)
7. └─dplyr::select_(...)
── ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ──────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. ├─base::as.data.frame(...) test-poplite.R:883:4
2. └─poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. ├─dplyr::select_(.data, .dots = use.dots)
4. └─poplite:::select_.Database(.data, .dots = use.dots)
5. ├─dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. ├─poplite:::join(.data, use.tables)
7. └─poplite:::join(.data, use.tables)
8. └─poplite:::.local(obj, ...)
9. └─dplyr::select_(...)
══ testthat results ═══════════════════════════════════════════════════════════
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-devel-linux-x86_64-debian-gcc
Version: 0.99.23
Check: examples
Result: ERROR
Running examples in ‘poplite-Ex.R’ failed
The error most likely occurred in:
> ### Name: External methods
> ### Title: Specific methods for generics defined in external packages.
> ### Aliases: filter select
> ### Keywords: utilities
>
> ### ** Examples
>
> if (require(Lahman))
+ {
+ baseball.teams <- makeSchemaFromData(TeamsFranchises, name="team_franch")
+ baseball.teams <- append(baseball.teams, makeSchemaFromData(Teams, name="teams"))
+
+ relationship(baseball.teams, from="team_franch", to="teams") <- franchID ~ franchID
+
+ baseball.db <- Database(baseball.teams, tempfile())
+
+ populate(baseball.db, teams=Teams, team_franch=TeamsFranchises)
+
+ select(baseball.db, .tables="teams")
+
+ select(baseball.db, .tables=c("teams", "team_franch"))
+
+ select(baseball.db, yearID:WCWin, franchName)
+
+ filter(baseball.db, active == "Y")
+
+ select(filter(baseball.db, active == "Y" & W > 50 & teamID == "CAL"), active, W, teamID)
+ }
Loading required package: Lahman
Starting team_franch
Starting teams
Warning: `select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
Warning: call dbDisconnect() when finished working with a connection
Error in UseMethod("select_") :
no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Calls: select ... join -> join -> .local -> .get.select.cols -> select_
Execution halted
Flavors: r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-patched-solaris-x86, r-oldrel-windows-ix86+x86_64
Version: 0.99.23
Check: tests
Result: ERROR
Running ‘testthat.R’ [38s/92s]
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
── Warning (test-poplite.R:598:5): Querying with Database objects ──────────────
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
── ERROR (test-poplite.R:655:5): Querying with Database objects ────────────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. └─poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. ├─dplyr::select_(.data, .dots = use.dots)
3. └─poplite:::select_.Database(.data, .dots = use.dots)
4. ├─poplite:::join(.data, use.tables)
5. └─poplite:::join(.data, use.tables)
6. └─poplite:::.local(obj, ...)
7. └─dplyr::select_(...)
── ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ──────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. ├─base::as.data.frame(...) test-poplite.R:883:4
2. └─poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. ├─dplyr::select_(.data, .dots = use.dots)
4. └─poplite:::select_.Database(.data, .dots = use.dots)
5. ├─dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. ├─poplite:::join(.data, use.tables)
7. └─poplite:::join(.data, use.tables)
8. └─poplite:::.local(obj, ...)
9. └─dplyr::select_(...)
══ testthat results ═══════════════════════════════════════════════════════════
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-devel-linux-x86_64-fedora-clang
Version: 0.99.23
Check: re-building of vignette outputs
Result: WARN
Error(s) in re-building vignettes:
--- re-building ‘poplite.Rnw’ using Sweave
Loading required package: dplyr
Attaching package: ‘dplyr’
The following objects are masked from ‘package:stats’:
filter, lag
The following objects are masked from ‘package:base’:
intersect, setdiff, setequal, union
Loading required package: DBI
Attaching package: ‘poplite’
The following object is masked from ‘package:dplyr’:
select
The following object is masked from ‘package:stats’:
filter
Error in makeSchemaFromData(dna, "dna") :
ERROR: The names of the supplied data.frame need to be modified for the database see correct.df.names
Starting clinical
Starting samples
Starting dna
Warning: `select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
Error: processing vignette 'poplite.Rnw' failed with diagnostics:
chunk 9
Error in UseMethod("select_") :
no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
--- failed re-building ‘poplite.Rnw’
SUMMARY: processing the following file failed:
‘poplite.Rnw’
Error: Vignette re-building failed.
Execution halted
Flavors: r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-oldrel-windows-ix86+x86_64
Version: 0.99.23
Check: tests
Result: ERROR
Running ‘testthat.R’ [36s/44s]
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
── Warning (test-poplite.R:598:5): Querying with Database objects ──────────────
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
── ERROR (test-poplite.R:655:5): Querying with Database objects ────────────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. └─poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. ├─dplyr::select_(.data, .dots = use.dots)
3. └─poplite:::select_.Database(.data, .dots = use.dots)
4. ├─poplite:::join(.data, use.tables)
5. └─poplite:::join(.data, use.tables)
6. └─poplite:::.local(obj, ...)
7. └─dplyr::select_(...)
── ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ──────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. ├─base::as.data.frame(...) test-poplite.R:883:4
2. └─poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. ├─dplyr::select_(.data, .dots = use.dots)
4. └─poplite:::select_.Database(.data, .dots = use.dots)
5. ├─dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. ├─poplite:::join(.data, use.tables)
7. └─poplite:::join(.data, use.tables)
8. └─poplite:::.local(obj, ...)
9. └─dplyr::select_(...)
══ testthat results ═══════════════════════════════════════════════════════════
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-devel-linux-x86_64-fedora-gcc
Version: 0.99.23
Check: tests
Result: ERROR
Running ‘testthat.R’ [30s/34s]
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
── Warning (test-poplite.R:598:5): Querying with Database objects ──────────────
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
── ERROR (test-poplite.R:655:5): Querying with Database objects ────────────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. └─poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. ├─dplyr::select_(.data, .dots = use.dots)
3. └─poplite:::select_.Database(.data, .dots = use.dots)
4. ├─poplite:::join(.data, use.tables)
5. └─poplite:::join(.data, use.tables)
6. └─poplite:::.local(obj, ...)
7. └─dplyr::select_(...)
── ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ──────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. ├─base::as.data.frame(...) test-poplite.R:883:4
2. └─poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. ├─dplyr::select_(.data, .dots = use.dots)
4. └─poplite:::select_.Database(.data, .dots = use.dots)
5. ├─dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. ├─poplite:::join(.data, use.tables)
7. └─poplite:::join(.data, use.tables)
8. └─poplite:::.local(obj, ...)
9. └─dplyr::select_(...)
══ testthat results ═══════════════════════════════════════════════════════════
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-patched-linux-x86_64
Version: 0.99.23
Check: tests
Result: ERROR
Running ‘testthat.R’ [51s/57s]
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
── Warning (test-poplite.R:598:5): Querying with Database objects ──────────────
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
── ERROR (test-poplite.R:655:5): Querying with Database objects ────────────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. └─poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. ├─dplyr::select_(.data, .dots = use.dots)
3. └─poplite:::select_.Database(.data, .dots = use.dots)
4. ├─poplite:::join(.data, use.tables)
5. └─poplite:::join(.data, use.tables)
6. └─poplite:::.local(obj, ...)
7. └─dplyr::select_(...)
── ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ──────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. ├─base::as.data.frame(...) test-poplite.R:883:4
2. └─poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. ├─dplyr::select_(.data, .dots = use.dots)
4. └─poplite:::select_.Database(.data, .dots = use.dots)
5. ├─dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. ├─poplite:::join(.data, use.tables)
7. └─poplite:::join(.data, use.tables)
8. └─poplite:::.local(obj, ...)
9. └─dplyr::select_(...)
══ testthat results ═══════════════════════════════════════════════════════════
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-patched-solaris-x86
Version: 0.99.23
Check: tests
Result: ERROR
Running ‘testthat.R’ [28s/31s]
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
── Warning (test-poplite.R:598:5): Querying with Database objects ──────────────
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
── ERROR (test-poplite.R:655:5): Querying with Database objects ────────────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. └─poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. ├─dplyr::select_(.data, .dots = use.dots)
3. └─poplite:::select_.Database(.data, .dots = use.dots)
4. ├─poplite:::join(.data, use.tables)
5. └─poplite:::join(.data, use.tables)
6. └─poplite:::.local(obj, ...)
7. └─dplyr::select_(...)
── ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ──────────
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
█
1. ├─base::as.data.frame(...) test-poplite.R:883:4
2. └─poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. ├─dplyr::select_(.data, .dots = use.dots)
4. └─poplite:::select_.Database(.data, .dots = use.dots)
5. ├─dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. ├─poplite:::join(.data, use.tables)
7. └─poplite:::join(.data, use.tables)
8. └─poplite:::.local(obj, ...)
9. └─dplyr::select_(...)
══ testthat results ═══════════════════════════════════════════════════════════
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-release-linux-x86_64
Version: 0.99.23
Check: package dependencies
Result: NOTE
Package suggested but not available for checking: ‘VariantAnnotation’
Flavor: r-oldrel-macos-x86_64
Version: 0.99.23
Check: tests
Result: ERROR
Running 'testthat.R' [23s]
Running the tests in 'tests/testthat.R' failed.
Complete output:
> library(testthat)
> library(Lahman)
> library(DBI)
> library(RSQLite)
> library(poplite)
Loading required package: dplyr
Attaching package: 'dplyr'
The following object is masked from 'package:testthat':
matches
The following objects are masked from 'package:stats':
filter, lag
The following objects are masked from 'package:base':
intersect, setdiff, setequal, union
Attaching package: 'poplite'
The following object is masked from 'package:dplyr':
select
The following object is masked from 'package:stats':
filter
>
> test.db.1 <- function()
+ {
+ samples <- data.frame(sample_id=as.integer(sapply(1:100, function(x) rep(x,2))), wave=as.integer(sapply(1:100, function(x) 1:2)), did_collect=sample(c("Y", "N"), size=100, replace=T))
+
+ dna <- samples[samples$did_collect == "Y",c("sample_id", "wave")]
+ dna$lab_id <- paste("dna", paste(dna$sample_id, dna$wave, sep="_"), sep="_")
+ dna$lab_id[sample.int(nrow(dna), size=10)] <- NA
+ dna$ng.ul <- abs(rnorm(n=nrow(dna), mean=146, sd=98))
+ dna$ng.ul[is.na(dna$lab_id)] <- NA
+
+ clinical <- data.frame(sample_id=1:100, sex=sample(c("M", "F"), size=100, replace=T), age=sample(1:20, 100, replace=T), status=sample(c(0L,1L), size=100, replace=T), var_wave_1=rnorm(n=100), var_wave_2=rnorm(n=100))
+ clinical <- clinical[-sample.int(nrow(clinical), 12),]
+
+ return(list(samples=samples, dna=dna, clinical=clinical))
+ }
>
> test.db.2 <- eval(structure(list(allele = structure(list(allele_id = 1:10, alleles = c(".",
+ "G", "A", ".", "A", "T", ".", "C", "A", "."), allele_num = c(-1L,
+ 0L, 1L, -1L, 0L, 1L, -1L, 0L, 1L, -1L), ref_id = c(1L, 1L, 1L,
+ 2L, 2L, 2L, 3L, 3L, 3L, 4L)), .Names = c("allele_id", "alleles",
+ "allele_num", "ref_id"), row.names = c(NA, -10L), class = "data.frame"),
+ genotype = structure(list(geno_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), geno_chr = c(1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L, 1L), allele_num = c(1L, 1L, 1L, 1L, 1L, 1L, 1L,
+ 1L, 1L, 1L), strain = c("NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ", "NODShiLtJ",
+ "NODShiLtJ", "NODShiLtJ"), ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L)), .Names = c("geno_id", "geno_chr",
+ "allele_num", "strain", "ref_id"), row.names = c(NA, -10L
+ ), class = "data.frame"), probe_align = structure(list(probe_align_id = 1:10,
+ probe_chr = c("1", "1", "1", "1", "1", "1", "1", "1",
+ "1", "1"), probe_start = c(3214633L, 3214895L, 3215576L,
+ 3216284L, 3216483L, 3216537L, 3216591L, 3421710L, 3421740L,
+ 3421808L), probe_end = c(3214657L, 3214919L, 3215600L,
+ 3216308L, 3216507L, 3216561L, 3216615L, 3421734L, 3421764L,
+ 3421832L), probe_ind = 23944:23953), .Names = c("probe_align_id",
+ "probe_chr", "probe_start", "probe_end", "probe_ind"), row.names = c(NA,
+ -10L), class = "data.frame"), probe_info = structure(list(
+ probe_ind = 1:10, fasta_name = c("chr1:3044331-3044355;+;GGGCTCAAATTCACCTGTGTTAACT",
+ "chr1:3044334-3044358;+;AGGGGGCTCAAATTCACCTGTGTTA", "chr1:3044335-3044359;+;GAGGGGGCTCAAATTCACCTGTGTT",
+ "chr1:3044336-3044360;+;GGAGGGGGCTCAAATTCACCTGTGT", "chr1:3044337-3044361;+;GGGAGGGGGCTCAAATTCACCTGTG",
+ "chr1:3044504-3044528;+;AAGGCTTGGGCTATGCGCTCTCCAG", "chr1:3044557-3044581;+;AAGGTCCTCGCTCCTCTTTCATATA",
+ "chr1:3044558-3044582;+;GAAGGTCCTCGCTCCTCTTTCATAT", "chr1:3044559-3044583;+;GGAAGGTCCTCGCTCCTCTTTCATA",
+ "chr1:3044560-3044584;+;AGGAAGGTCCTCGCTCCTCTTTCAT"),
+ probe_id = c(271822L, 866088L, 240008L, 34772L, 396933L,
+ 613322L, 984143L, 826914L, 1075207L, 160847L), align_status = c("MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped", "MultiMapped", "MultiMapped", "MultiMapped",
+ "MultiMapped")), .Names = c("probe_ind", "fasta_name",
+ "probe_id", "align_status"), row.names = c(NA, -10L), class = "data.frame"),
+ probe_to_snp = structure(list(probe_snp_id = 1:10, ref_id = c(1L,
+ 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 9L), probe_align_id = c(137L,
+ 137L, 252L, 263L, 561L, 601L, 606L, 622L, 635L, 636L)), .Names = c("probe_snp_id",
+ "ref_id", "probe_align_id"), row.names = c(NA, -10L), class = "data.frame"),
+ reference = structure(list(ref_id = c(1L, 2L, 3L, 4L, 5L,
+ 6L, 7L, 8L, 9L, 11L), seqnames = c("1", "1", "1", "1", "1",
+ "1", "1", "1", "1", "1"), start = c(4785683L, 4785703L, 8595537L,
+ 8682000L, 10719780L, 12990759L, 13114284L, 13122474L, 13125617L,
+ 13150850L), end = c(4785683L, 4785703L, 8595537L, 8682000L,
+ 10719780L, 12990759L, 13114284L, 13122474L, 13125617L, 13150850L
+ ), filter = c("TRUE", "TRUE", "TRUE", "TRUE", "TRUE", "TRUE",
+ "TRUE", "TRUE", "TRUE", "TRUE"), vcf_annot_id = c(1L, 1L,
+ 1L, 1L, 1L, 1L, 1L, 1L, 1L, 1L)), .Names = c("ref_id", "seqnames",
+ "start", "end", "filter", "vcf_annot_id"), row.names = c(NA,
+ -10L), class = "data.frame"), vcf_annot = structure(list(
+ vcf_annot_id = 1L, vcf_name = "/Users/bottomly/Desktop/resources/vcfs/mgp.v3.snps.rsIDdbSNPv137.vcf.gz",
+ type = "SNV"), .Names = c("vcf_annot_id", "vcf_name",
+ "type"), row.names = c(NA, -1L), class = "data.frame")), .Names = c("allele",
+ "genotype", "probe_align", "probe_info", "probe_to_snp", "reference",
+ "vcf_annot")))
>
> test.schema.2 <- list(probe_info=list(db.cols=c("probe_ind", "fasta_name", "probe_id", "align_status"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (fasta_name)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=NULL),
+ probe_align=list(db.cols=c("probe_align_id", "probe_chr", "probe_start", "probe_end", "probe_ind"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (probe_chr, probe_start, probe_end, probe_ind)",
+ dta.func=function(x) x, should.ignore=FALSE, foreign.keys=list(probe_info=list(local.keys="probe_ind", ext.keys="fasta_name"))),
+ vcf_annot=list(db.cols=c("vcf_annot_id", "vcf_name", "type"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "TEXT"),
+ db.constr="CONSTRAINT probe_idx UNIQUE (vcf_name, type)",
+ dta.func=function(x) x,
+ should.ignore=TRUE, foreign.keys=NULL),
+ reference=list(db.cols=c("ref_id", "seqnames", "start", "end", "filter", "vcf_annot_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT ref_idx UNIQUE (seqnames, start, end, vcf_annot_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")))),
+ allele=list(db.cols=c("allele_id", "alleles", "allele_num", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "TEXT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT alelle_idx UNIQUE (alleles, allele_num, ref_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ genotype=list(db.cols=c("geno_id", "geno_chr", "allele_num","strain", "ref_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER", "TEXT", "INTEGER"),
+ db.constr="CONSTRAINT geno_idx UNIQUE (ref_id, strain, geno_chr, allele_num)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")))),
+ probe_to_snp=list(db.cols=c("probe_snp_id", "ref_id", "probe_align_id"),
+ db.schema=c("INTEGER PRIMARY KEY AUTOINCREMENT", "INTEGER", "INTEGER"),
+ db.constr="CONSTRAINT p_s_idx UNIQUE (ref_id, probe_align_id)",
+ dta.func=function(x) x, should.ignore=TRUE, foreign.keys=list(vcf_annot=list(local.keys="vcf_annot_id", ext.keys=c("vcf_name", "type")),
+ reference=list(local.keys="ref_id", ext.keys=c("seqnames", "start", "end", "vcf_annot_id")),
+ probe_align=list(local.keys="probe_align_id", ext.keys=c("probe_chr", "probe_start", "probe_end")))))
>
>
>
>
>
> test_check("poplite")
-- Warning (test-poplite.R:598:5): Querying with Database objects --------------
`select_()` is deprecated as of dplyr 0.7.0.
Please use `select()` instead.
This warning is displayed once every 8 hours.
Call `lifecycle::last_warnings()` to see where this warning was generated.
-- ERROR (test-poplite.R:655:5): Querying with Database objects ----------------
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
x
1. \-poplite::select(sample.tracking.db, sample_id:dna_ind, .tables = "samples") test-poplite.R:655:4
2. +-dplyr::select_(.data, .dots = use.dots)
3. \-poplite:::select_.Database(.data, .dots = use.dots)
4. +-poplite:::join(.data, use.tables)
5. \-poplite:::join(.data, use.tables)
6. \-poplite:::.local(obj, ...)
7. \-dplyr::select_(...)
-- ERROR (test-poplite.R:883:5): oligoMask queries that break poplite ----------
Error: no applicable method for 'select_' applied to an object of class "c('tbl_SQLiteConnection', 'tbl_dbi', 'tbl_sql', 'tbl_lazy', 'tbl')"
Backtrace:
x
1. +-base::as.data.frame(...) test-poplite.R:883:4
2. \-poplite::select(test.database.1, probe_id, fasta_name, align_status)
3. +-dplyr::select_(.data, .dots = use.dots)
4. \-poplite:::select_.Database(.data, .dots = use.dots)
5. +-dplyr::select_(join(.data, use.tables), .dots = as.list(clean.cols))
6. +-poplite:::join(.data, use.tables)
7. \-poplite:::join(.data, use.tables)
8. \-poplite:::.local(obj, ...)
9. \-dplyr::select_(...)
== testthat results ===========================================================
Warning (test-poplite.R:598:5): Querying with Database objects
ERROR (test-poplite.R:655:5): Querying with Database objects
ERROR (test-poplite.R:883:5): oligoMask queries that break poplite
[ FAIL 2 | WARN 1 | SKIP 0 | PASS 129 ]
Error: Test failures
In addition: Warning message:
call dbDisconnect() when finished working with a connection
Execution halted
Flavor: r-oldrel-windows-ix86+x86_64