Last updated on 2022-12-19 07:53:25 CET.
| Flavor | Version | Tinstall | Tcheck | Ttotal | Status | Flags |
|---|---|---|---|---|---|---|
| r-devel-linux-x86_64-debian-clang | 1.1.6 | 6.61 | 52.17 | 58.78 | ERROR | |
| r-devel-linux-x86_64-debian-gcc | 1.1.6 | 6.00 | 40.51 | 46.51 | ERROR | |
| r-devel-linux-x86_64-fedora-clang | 1.1.6 | 78.65 | ERROR | |||
| r-devel-windows-x86_64 | 1.1.6 | 17.00 | 78.00 | 95.00 | ERROR | |
| r-patched-linux-x86_64 | 1.1.6 | 7.52 | 52.88 | 60.40 | ERROR | |
| r-release-linux-x86_64 | 1.1.6 | 5.41 | 51.36 | 56.77 | ERROR | |
| r-release-macos-arm64 | 1.1.6 | 27.00 | NOTE | |||
| r-release-macos-x86_64 | 1.1.6 | 49.00 | NOTE | |||
| r-release-windows-x86_64 | 1.1.6 | 29.00 | 84.00 | 113.00 | ERROR | |
| r-oldrel-macos-arm64 | 1.1.6 | 35.00 | NOTE | |||
| r-oldrel-macos-x86_64 | 1.1.6 | 49.00 | NOTE | |||
| r-oldrel-windows-ix86+x86_64 | 1.1.6 | 14.00 | 72.00 | 86.00 | ERROR |
Version: 1.1.6
Check: LazyData
Result: NOTE
'LazyData' is specified without a 'data' directory
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-devel-linux-x86_64-fedora-clang, r-devel-windows-x86_64, r-patched-linux-x86_64, r-release-linux-x86_64, r-release-macos-arm64, r-release-macos-x86_64, r-release-windows-x86_64, r-oldrel-macos-arm64, r-oldrel-macos-x86_64, r-oldrel-windows-ix86+x86_64
Version: 1.1.6
Check: examples
Result: ERROR
Running examples in 'crispRdesignR-Ex.R' failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: getofftargetdata
> ### Title: Off Target Data Frame Creation
> ### Aliases: getofftargetdata
>
> ### ** Examples
>
>
> ## Quick example without off-target searching or annotation
> ## First generate data with the sgRNA_Design Function
> testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
> usergenome <- "placeholder"
> gtfname <- "placeholder"
> alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
Searching sequence for possible target sites
Error in `stringr::str_replace_all()`:
! `string` must be a vector, not a <DNAString> object.
Backtrace:
x
1. +-crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
2. | \-stringr::str_replace_all(revsetPAM, "N", ".")
3. | \-stringr:::check_lengths(string, pattern, replacement)
4. | \-vctrs::vec_size_common(...)
5. \-vctrs:::stop_scalar_type(...)
6. \-vctrs:::stop_vctrs(...)
7. \-rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
Execution halted
Flavor: r-devel-linux-x86_64-debian-clang
Version: 1.1.6
Check: examples
Result: ERROR
Running examples in ‘crispRdesignR-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: getofftargetdata
> ### Title: Off Target Data Frame Creation
> ### Aliases: getofftargetdata
>
> ### ** Examples
>
>
> ## Quick example without off-target searching or annotation
> ## First generate data with the sgRNA_Design Function
> testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
> usergenome <- "placeholder"
> gtfname <- "placeholder"
> alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
Searching sequence for possible target sites
Error in `stringr::str_replace_all()`:
! `string` must be a vector, not a <DNAString> object.
Backtrace:
▆
1. ├─crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
2. │ └─stringr::str_replace_all(revsetPAM, "N", ".")
3. │ └─stringr:::check_lengths(string, pattern, replacement)
4. │ └─vctrs::vec_size_common(...)
5. └─vctrs:::stop_scalar_type(...)
6. └─vctrs:::stop_vctrs(...)
7. └─rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
Execution halted
Flavors: r-devel-linux-x86_64-debian-gcc, r-patched-linux-x86_64
Version: 1.1.6
Check: dependencies in R code
Result: NOTE
Namespaces in Imports field not imported from:
‘DT’ ‘gbm’
All declared Imports should be used.
Flavors: r-devel-linux-x86_64-fedora-clang, r-release-macos-arm64, r-release-macos-x86_64, r-oldrel-macos-arm64, r-oldrel-macos-x86_64
Version: 1.1.6
Check: examples
Result: ERROR
Running examples in ‘crispRdesignR-Ex.R’ failed
The error most likely occurred in:
> ### Name: getofftargetdata
> ### Title: Off Target Data Frame Creation
> ### Aliases: getofftargetdata
>
> ### ** Examples
>
>
> ## Quick example without off-target searching or annotation
> ## First generate data with the sgRNA_Design Function
> testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
> usergenome <- "placeholder"
> gtfname <- "placeholder"
> alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
Searching sequence for possible target sites
Error in `stringr::str_replace_all()`:
! `string` must be a vector, not a <DNAString> object.
Backtrace:
▆
1. ├─crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
2. │ └─stringr::str_replace_all(revsetPAM, "N", ".")
3. │ └─stringr:::check_lengths(string, pattern, replacement)
4. │ └─vctrs::vec_size_common(...)
5. └─vctrs:::stop_scalar_type(...)
6. └─vctrs:::stop_vctrs(...)
7. └─rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
Execution halted
Flavors: r-devel-linux-x86_64-fedora-clang, r-devel-windows-x86_64
Version: 1.1.6
Check: examples
Result: ERROR
Running examples in ‘crispRdesignR-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: getofftargetdata
> ### Title: Off Target Data Frame Creation
> ### Aliases: getofftargetdata
>
> ### ** Examples
>
>
> ## Quick example without off-target searching or annotation
> ## First generate data with the sgRNA_Design Function
> testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
> usergenome <- "placeholder"
> gtfname <- "placeholder"
> alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
Searching sequence for possible target sites
Error in `stringr::str_replace_all()`:
! `string` must be a vector, not a <DNAString> object.
Backtrace:
▆
1. ├─crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
2. │ └─stringr::str_replace_all(revsetPAM, "N", ".")
3. │ └─stringr:::check_lengths(string, pattern, replacement)
4. │ └─vctrs::vec_size_common(...)
5. └─vctrs:::stop_scalar_type(`<fn>`(`<DNAStrng>`), "string", `<env>`)
6. └─vctrs:::stop_vctrs(...)
7. └─rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
Execution halted
Flavor: r-release-linux-x86_64
Version: 1.1.6
Check: package dependencies
Result: NOTE
Package suggested but not available for checking: ‘BSgenome.Scerevisiae.UCSC.sacCer2’
Flavors: r-release-macos-arm64, r-release-macos-x86_64, r-oldrel-macos-arm64, r-oldrel-macos-x86_64
Version: 1.1.6
Check: examples
Result: ERROR
Running examples in 'crispRdesignR-Ex.R' failed
The error most likely occurred in:
> ### Name: getofftargetdata
> ### Title: Off Target Data Frame Creation
> ### Aliases: getofftargetdata
>
> ### ** Examples
>
>
> ## Quick example without off-target searching or annotation
> ## First generate data with the sgRNA_Design Function
> testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
> usergenome <- "placeholder"
> gtfname <- "placeholder"
> alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
Searching sequence for possible target sites
Error in `stringr::str_replace_all()`:
! `string` must be a vector, not a <DNAString> object.
Backtrace:
▆
1. ├─crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
2. │ └─stringr::str_replace_all(revsetPAM, "N", ".")
3. │ └─stringr:::check_lengths(string, pattern, replacement)
4. │ └─vctrs::vec_size_common(...)
5. └─vctrs:::stop_scalar_type(`<fn>`(`<DNAStrng>`), "string", `<env>`)
6. └─vctrs:::stop_vctrs(...)
7. └─rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
Execution halted
Flavor: r-release-windows-x86_64
Version: 1.1.6
Check: examples
Result: ERROR
Running examples in 'crispRdesignR-Ex.R' failed
The error most likely occurred in:
> ### Name: getofftargetdata
> ### Title: Off Target Data Frame Creation
> ### Aliases: getofftargetdata
>
> ### ** Examples
>
>
> ## Quick example without off-target searching or annotation
> ## First generate data with the sgRNA_Design Function
> testseq <- "GGCAGAGCTTCGTATGTCGGCGATTCATCTCAAGTAGAAGATCCTGGTGCAGTAGG"
> usergenome <- "placeholder"
> gtfname <- "placeholder"
> alldata <- sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
Searching sequence for possible target sites
Error in `stringr::str_replace_all()`:
! `string` must be a vector, not a <DNAString> object.
Backtrace:
x
1. +-crispRdesignR::sgRNA_design(testseq, usergenome, gtfname, calloffs = FALSE)
2. | \-stringr::str_replace_all(revsetPAM, "N", ".")
3. | \-stringr:::check_lengths(string, pattern, replacement)
4. | \-vctrs::vec_size_common(...)
5. \-vctrs:::stop_scalar_type(...)
6. \-vctrs:::stop_vctrs(...)
7. \-rlang::abort(message, class = c(class, "vctrs_error"), ..., call = vctrs_error_call(call))
Execution halted
Flavor: r-oldrel-windows-ix86+x86_64